standard scrambled sequence Search Results


90
Gene Tools Inc standard scrambled sequence 5’cctcttacctcagttacaatttata-3
Standard Scrambled Sequence 5’cctcttacctcagttacaatttata 3, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/standard scrambled sequence 5’cctcttacctcagttacaatttata-3/product/Gene Tools Inc
Average 90 stars, based on 1 article reviews
standard scrambled sequence 5’cctcttacctcagttacaatttata-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Gene Tools Inc standard scrambled sequence
Standard Scrambled Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/standard scrambled sequence/product/Gene Tools Inc
Average 90 stars, based on 1 article reviews
standard scrambled sequence - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results